ID: 918311311_918311317

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 918311311 918311317
Species Human (GRCh38) Human (GRCh38)
Location 1:183287584-183287606 1:183287606-183287628
Sequence CCTCACAGCTGACCCAGAAGCAA ATCCCACTGGGCCAAGGTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!