ID: 918333274_918333279

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 918333274 918333279
Species Human (GRCh38) Human (GRCh38)
Location 1:183480808-183480830 1:183480836-183480858
Sequence CCTTACCTGCATTTCTTCCTGCA CAAGAAGGAAGCATTGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 453} {0: 1, 1: 0, 2: 2, 3: 19, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!