ID: 918363976_918363980

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 918363976 918363980
Species Human (GRCh38) Human (GRCh38)
Location 1:183787283-183787305 1:183787316-183787338
Sequence CCTACCACCTTAAAACTCTACTC TCTCCTTCAGGATGCCTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!