ID: 918364055_918364060

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 918364055 918364060
Species Human (GRCh38) Human (GRCh38)
Location 1:183787911-183787933 1:183787940-183787962
Sequence CCACTATGAGTGGAAGTAGCCTG TCAGCAGATGCAGATGCTGGTGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 127, 3: 269, 4: 797} {0: 1, 1: 1, 2: 7, 3: 75, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!