ID: 918374229_918374231

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 918374229 918374231
Species Human (GRCh38) Human (GRCh38)
Location 1:183892669-183892691 1:183892709-183892731
Sequence CCAGACATTTGTTGAATGCCTAA ACCTGCTTCTAGAAATATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 279} {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!