ID: 918400296_918400306 |
View in Genome Browser |
Spacer: 7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 918400296 | 918400306 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:184156257-184156279 | 1:184156287-184156309 |
| Sequence | CCCACAAAGGCTGTCTTGTCCCC | AAGGAGGTTTGTTTTGGGAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 79, 1: 171, 2: 346, 3: 323, 4: 631} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||