ID: 918471914_918471927

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 918471914 918471927
Species Human (GRCh38) Human (GRCh38)
Location 1:184884075-184884097 1:184884119-184884141
Sequence CCAGATAACTGCCCCATGTTCTG CTGCCTGAAAACCAGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} {0: 1, 1: 0, 2: 1, 3: 25, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!