ID: 918560083_918560093

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 918560083 918560093
Species Human (GRCh38) Human (GRCh38)
Location 1:185855168-185855190 1:185855199-185855221
Sequence CCCTGCCCCCTCTGGCTCTTGCT AAACAAGGGAACCACTTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 73, 4: 638} {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!