ID: 918623672_918623679

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 918623672 918623679
Species Human (GRCh38) Human (GRCh38)
Location 1:186633849-186633871 1:186633900-186633922
Sequence CCACCAAATTGCCCTTAAAAACT TTTGAGTAATAATAAAACTCTGG
Strand - +
Off-target summary No data {0: 261, 1: 330, 2: 181, 3: 92, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!