ID: 918647718_918647724

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 918647718 918647724
Species Human (GRCh38) Human (GRCh38)
Location 1:186921808-186921830 1:186921835-186921857
Sequence CCCTTTGCTACTAGTACTGCTGC TGTCCTCTTGACCACTGTGGGGG
Strand - +
Off-target summary {0: 21, 1: 33, 2: 14, 3: 27, 4: 170} {0: 1, 1: 11, 2: 26, 3: 60, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!