|
Left Crispr |
Right Crispr |
| Crispr ID |
918652279 |
918652286 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:186980071-186980093
|
1:186980118-186980140
|
| Sequence |
CCGAGTAGCTGGGACTACAGGCG |
TTTTGTGTTTGTAGTGAAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 42478, 1: 106370, 2: 174364, 3: 132619, 4: 206690} |
{0: 1, 1: 14, 2: 779, 3: 20710, 4: 219214} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|