ID: 918774492_918774495

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 918774492 918774495
Species Human (GRCh38) Human (GRCh38)
Location 1:188610745-188610767 1:188610783-188610805
Sequence CCTTCCATCTTCAGCAAATGACT GACATCTCTTTGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 198, 3: 188, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!