ID: 918902291_918902296

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 918902291 918902296
Species Human (GRCh38) Human (GRCh38)
Location 1:190438791-190438813 1:190438842-190438864
Sequence CCTCTCAAGATGCCATAATAGTG TGACAGGAAGAGTAAAGGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100} {0: 1, 1: 1, 2: 1, 3: 21, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!