ID: 918952662_918952667

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 918952662 918952667
Species Human (GRCh38) Human (GRCh38)
Location 1:191160129-191160151 1:191160143-191160165
Sequence CCAATTTAAAAATGGGCAAATGG GGCAAATGGGCTTGGTGCGGTGG
Strand - +
Off-target summary {0: 4, 1: 66, 2: 556, 3: 2202, 4: 6991} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!