|
Left Crispr |
Right Crispr |
| Crispr ID |
919001559 |
919001566 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:191838313-191838335
|
1:191838353-191838375
|
| Sequence |
CCATCTGTGAACCGGAAAGCAGG |
ATCTGATGGTGCCTTGATTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 78, 3: 254, 4: 618} |
{0: 2, 1: 22, 2: 270, 3: 764, 4: 1650} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|