ID: 919005352_919005354

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 919005352 919005354
Species Human (GRCh38) Human (GRCh38)
Location 1:191891610-191891632 1:191891644-191891666
Sequence CCAGTCAGTGAAGCTGTGGGAAA CATTGTAGACACACTGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!