ID: 919093586_919093590

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 919093586 919093590
Species Human (GRCh38) Human (GRCh38)
Location 1:193002501-193002523 1:193002530-193002552
Sequence CCGCCTCTCGGGCACAAGCGATT CCTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 18, 2: 1012, 3: 18644, 4: 77250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!