|
Left Crispr |
Right Crispr |
| Crispr ID |
919112216 |
919112222 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:193235280-193235302
|
1:193235318-193235340
|
| Sequence |
CCTTCCTCCTTTCTCTTCTCCAA |
GTTTCTTCATTTATACAATGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 17, 3: 197, 4: 1703} |
{0: 2, 1: 20, 2: 230, 3: 1374, 4: 6206} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|