ID: 919141965_919141967

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 919141965 919141967
Species Human (GRCh38) Human (GRCh38)
Location 1:193583613-193583635 1:193583636-193583658
Sequence CCCACGACACGGAATTGTGGGAG CTACAATTCAAGCTGAGATTTGG
Strand - +
Off-target summary No data {0: 23, 1: 4417, 2: 9008, 3: 9039, 4: 8318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!