ID: 919241772_919241775

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 919241772 919241775
Species Human (GRCh38) Human (GRCh38)
Location 1:194924206-194924228 1:194924240-194924262
Sequence CCATCTTCTGCAGATAACTACTC GACAGCTATTGGCCTGTTAATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 196, 3: 185, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!