ID: 919318277_919318282

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 919318277 919318282
Species Human (GRCh38) Human (GRCh38)
Location 1:196001886-196001908 1:196001918-196001940
Sequence CCAATCTAATGAGCTGCCAGTGC ACAAATAGGCAGAATGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 24, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!