ID: 919342994_919342999

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 919342994 919342999
Species Human (GRCh38) Human (GRCh38)
Location 1:196337545-196337567 1:196337573-196337595
Sequence CCTCATCTCCTACTATTCTTCCA CACTGTGTTTGAGGCACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 79, 4: 584} {0: 1, 1: 0, 2: 1, 3: 32, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!