ID: 919350902_919350907

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 919350902 919350907
Species Human (GRCh38) Human (GRCh38)
Location 1:196452778-196452800 1:196452800-196452822
Sequence CCCAGGGAAAGCCAGTGTTGAAG GTCTGAAGTCAGTTAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 218} {0: 1, 1: 0, 2: 0, 3: 20, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!