ID: 919351824_919351826

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 919351824 919351826
Species Human (GRCh38) Human (GRCh38)
Location 1:196466890-196466912 1:196466903-196466925
Sequence CCAAGCAGGGTCAGCCTTGGGTA GCCTTGGGTATAATGCAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 145} {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!