ID: 919354018_919354022

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 919354018 919354022
Species Human (GRCh38) Human (GRCh38)
Location 1:196498428-196498450 1:196498443-196498465
Sequence CCTCCCTCTTTCTTCTAATTCTG TAATTCTGCAATATTGGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 600} {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!