ID: 919368057_919368066

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 919368057 919368066
Species Human (GRCh38) Human (GRCh38)
Location 1:196690691-196690713 1:196690738-196690760
Sequence CCCTGCCCCTGGTGGAGTGCACT AGCAGTGTCTGATTTACATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 331} {0: 6, 1: 116, 2: 251, 3: 366, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!