ID: 919377059_919377064

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 919377059 919377064
Species Human (GRCh38) Human (GRCh38)
Location 1:196808307-196808329 1:196808353-196808375
Sequence CCTATCCCATGTGAATGAAAATA GATTGTTATTTCCAGTGAATAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 30, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!