ID: 919381908_919381920

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 919381908 919381920
Species Human (GRCh38) Human (GRCh38)
Location 1:196870486-196870508 1:196870526-196870548
Sequence CCCTCATCCCTGAAGAGATACTC AGCATGGGAAATGGAAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 153} {0: 1, 1: 0, 2: 4, 3: 42, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!