|
Left Crispr |
Right Crispr |
| Crispr ID |
919382506 |
919382520 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:196876229-196876251
|
1:196876265-196876287
|
| Sequence |
CCCTCCATGATCCCCTTAAAGTC |
CCCTTCACAGAACAGATTTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 25, 3: 56, 4: 229} |
{0: 1, 1: 1, 2: 4, 3: 13, 4: 220} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|