ID: 919400754_919400759

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 919400754 919400759
Species Human (GRCh38) Human (GRCh38)
Location 1:197113348-197113370 1:197113401-197113423
Sequence CCCAGAATCTAAAATAGAAGTAG CTGAAGGTAGCATGGCAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 83, 3: 815, 4: 2437} {0: 1, 1: 0, 2: 3, 3: 32, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!