ID: 919418435_919418441

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 919418435 919418441
Species Human (GRCh38) Human (GRCh38)
Location 1:197340835-197340857 1:197340872-197340894
Sequence CCATTTTCACTCTGCTAATAAAG GGGTGATTTATTTAGGAAAAAGG
Strand - +
Off-target summary {0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600} {0: 1, 1: 0, 2: 17, 3: 558, 4: 5581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!