ID: 919423883_919423895

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 919423883 919423895
Species Human (GRCh38) Human (GRCh38)
Location 1:197405796-197405818 1:197405835-197405857
Sequence CCCGGTAGCTGCCCCGTCTGAGA ACCTGGCAGCCACCCCGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 215, 2: 514, 3: 1103, 4: 2736} {0: 4, 1: 88, 2: 752, 3: 3393, 4: 5268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!