|
Left Crispr |
Right Crispr |
Crispr ID |
919423883 |
919423897 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:197405796-197405818
|
1:197405843-197405865
|
Sequence |
CCCGGTAGCTGCCCCGTCTGAGA |
GCCACCCCGTCTGGGAAGTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 215, 2: 514, 3: 1103, 4: 2736} |
{0: 1882, 1: 2591, 2: 6222, 3: 11614, 4: 5578} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|