ID: 919429139_919429142

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 919429139 919429142
Species Human (GRCh38) Human (GRCh38)
Location 1:197471304-197471326 1:197471329-197471351
Sequence CCAGCAAGAGACTTCAAACCCTG AACTGCAGTCTTACAGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112} {0: 1, 1: 0, 2: 2, 3: 13, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!