ID: 919441696_919441703

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 919441696 919441703
Species Human (GRCh38) Human (GRCh38)
Location 1:197642309-197642331 1:197642353-197642375
Sequence CCTATTACCAGGTTAGGATAGCA TTTCTTTCAAGTGGCTCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!