|
Left Crispr |
Right Crispr |
| Crispr ID |
919446148 |
919446152 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:197708074-197708096
|
1:197708113-197708135
|
| Sequence |
CCTACGCCCACGGAATCGCGCTG |
TCTGAGATCAAACTGCAAGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 450, 2: 786, 3: 859, 4: 831} |
{0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|