ID: 919455761_919455765

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 919455761 919455765
Species Human (GRCh38) Human (GRCh38)
Location 1:197818221-197818243 1:197818246-197818268
Sequence CCTCCAGCAGTGGCTGCATGGCA AAGAGAGAATCTGTGCTTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 71, 4: 472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!