ID: 919468884_919468889

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 919468884 919468889
Species Human (GRCh38) Human (GRCh38)
Location 1:197954406-197954428 1:197954435-197954457
Sequence CCTCAAAACTCAACTTTGTAAGC AAGACCACCAGGCTATGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!