ID: 919536708_919536715

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 919536708 919536715
Species Human (GRCh38) Human (GRCh38)
Location 1:198796817-198796839 1:198796832-198796854
Sequence CCATCCCACAGCTCCATTAGACA ATTAGACAGTGCCCCAGTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 27, 3: 59, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!