ID: 919690890_919690895

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 919690890 919690895
Species Human (GRCh38) Human (GRCh38)
Location 1:200527476-200527498 1:200527504-200527526
Sequence CCCAAAAGTCCAGAAGAGCAAAT CTTCAGACACAGCTGGATCCAGG
Strand - +
Off-target summary No data {0: 4, 1: 29, 2: 120, 3: 310, 4: 648}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!