|
Left Crispr |
Right Crispr |
| Crispr ID |
919697208 |
919697217 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:200589841-200589863
|
1:200589861-200589883
|
| Sequence |
CCGGTTTCCCTACATTGCCCCTG |
CTGGCTGGTCTTGAACTCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 19, 4: 216} |
{0: 132, 1: 9529, 2: 19685, 3: 30563, 4: 28402} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|