ID: 919729079_919729093

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 919729079 919729093
Species Human (GRCh38) Human (GRCh38)
Location 1:200901494-200901516 1:200901528-200901550
Sequence CCCGCTGCCCTCCAGGCCCACAG CTCTGGGTCAGGGTAGTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 82, 4: 654} {0: 1, 1: 0, 2: 4, 3: 24, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!