ID: 919740368_919740373

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 919740368 919740373
Species Human (GRCh38) Human (GRCh38)
Location 1:200977538-200977560 1:200977564-200977586
Sequence CCAGGGGAGAGCTCCACTCTAGT CTATGAGTCAACTCCCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102} {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!