ID: 919744440_919744447

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 919744440 919744447
Species Human (GRCh38) Human (GRCh38)
Location 1:200999870-200999892 1:200999906-200999928
Sequence CCGTGCTCCTCACCTCCTCCGCC TCTCCTCGCTGTTCTCCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 1035} {0: 1, 1: 1, 2: 1, 3: 17, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!