ID: 919744441_919744447

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 919744441 919744447
Species Human (GRCh38) Human (GRCh38)
Location 1:200999877-200999899 1:200999906-200999928
Sequence CCTCACCTCCTCCGCCTCGTTCT TCTCCTCGCTGTTCTCCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 121, 4: 1057} {0: 1, 1: 1, 2: 1, 3: 17, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!