ID: 919744547_919744556

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 919744547 919744556
Species Human (GRCh38) Human (GRCh38)
Location 1:201000320-201000342 1:201000345-201000367
Sequence CCTTGGGGACGGGCAGGGTCCAC GGGCGGTCTGAGGGCTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 175} {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!