ID: 919762091_919762100

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 919762091 919762100
Species Human (GRCh38) Human (GRCh38)
Location 1:201104353-201104375 1:201104368-201104390
Sequence CCCTCCCCAATCCCTTGAAAACC TGAAAACCACTGACCTAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 513} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!