ID: 919763214_919763224

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 919763214 919763224
Species Human (GRCh38) Human (GRCh38)
Location 1:201111237-201111259 1:201111278-201111300
Sequence CCACGTTTCTCTTGTCCTTCCAG CCTTCTAGGGAACAGCTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 311} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!