ID: 919768151_919768163

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 919768151 919768163
Species Human (GRCh38) Human (GRCh38)
Location 1:201140555-201140577 1:201140589-201140611
Sequence CCTCCTCTTCCTCTTCCAGTTCT GCAGGAGAGCTCCTGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 67, 3: 486, 4: 3402} {0: 1, 1: 0, 2: 2, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!