ID: 919769480_919769484

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 919769480 919769484
Species Human (GRCh38) Human (GRCh38)
Location 1:201148098-201148120 1:201148125-201148147
Sequence CCCAAAGGAAGAGTAGACCCACT TCTAACAGCACTCTTGCGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123} {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!